Loading...
The URL can be used to link to this page
Your browser does not support the video tag.
Agenda - Accessibility Advisory Committee - 20220309
Town of Aurora Accessibility Advisory Committee Meeting Agenda Date:March 9, 2022 Time:7 p.m. Location:Video Conference Due to the COVID-19 pandemic, meetings will be available to the public via live stream only on the Town’s YouTube Channel. To participate electronically, please visit aurora.ca/participation. Pages 1.Call to Order 2.Approval of the Agenda 3.Declarations of Pecuniary Interest and General Nature Thereof 4.Receipt of the Minutes 4.1.Accessibility Advisory Committee Meeting Minutes of February 9, 2022 1 That the Accessibility Advisory Committee meeting minutes of February 9, 2022, be received for information. 5.Delegations 6.Matters for Consideration 6.1.Memorandum from Accessibility Advisor; Re: Pre-Application Consultation PRE-2022-01, 375 Addison Hall 6 That the memorandum regarding Pre-Application Consultation PRE-2022-01, 375 Addison Hall, be received; and 1. That the Accessibility Advisory Committee comments regarding Pre-Application Consultation PRE-2022-01 be received and referred to staff for consideration and further action as appropriate. 2. 6.2.Memorandum from Accessibility Advisor; Re: Site Plan Application OPA- 2021-03, ZBA-2021-03, and SP-2021-07 (Submission #4), 15296 to 15314 Yonge Street 14 That the memorandum regarding Site Plan Application OPA- 2021-03, ZBA-2021-03, and SP-2021-07 (Submission #4), 15296 to 15314 Yonge Street, be received; and 1. That the Accessibility Advisory Committee comments regarding Site Plan Application OPA-2021-03, ZBA-2021-03, and SP-2021- 07 (Submission #4) be received and referred to staff for consideration and further action as appropriate. 2. 6.3.Memorandum from Accessibility Advisor; Re: Site Plan Application SP- 2021-14 (Submission #1), 32 Don Hillock Drive 24 That the memorandum regarding Site Plan Application SP-2021- 14 (Submission #1), 32 Don Hillock Drive, be received; and 1. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-14 (Submission #1) be received and referred to staff for consideration and further action as appropriate. 2. 6.4.Memorandum from Accessibility Advisor; Re: Site Plan Application SP- 2021-15 (Submission #1), 420 Addison Hall Circle 35 That the memorandum regarding Site Plan Application SP-2021- 15 (Submission #1), 420 Addison Hall Circle, be received; and 1. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-15 (Submission #1) be received and referred to staff for consideration and further action as appropriate. 2. 6.5.Memorandum from Accessibility Advisor; Re: Site Plan Application OPA- 2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2), 162, 306, 370, 434, and 488 St. John's Sideroad 55 That the memorandum regarding Site Plan Application OPA- 2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2), 162, 306, 370, 434, and 488 St. John's Sideroad, be received; and 1. That the Accessibility Advisory Committee comments regarding Site Plan Application OPA-2021-02, ZBA-2021-02, and SUB-2021- 01 (Submission #2) be received and referred to staff for consideration and further action as appropriate. 2. 6.6.Round Table Discussion; Re: Town of Aurora Multi-Year Accessibility Plan 2022 to 2026 (Link to Multi-Year Accessibility Plan) That the Accessibility Advisory Committee comments regarding the Town of Aurora Multi-Year Accessibility Plan 2022 to 2026 be received and referred to staff for consideration and further action as appropriate. 1. 7.Informational Items 8.Adjournment 1 Town of Aurora Accessibility Advisory Committee Meeting Minutes Date: Time: Location: Wednesday, February 9, 2022 7:00 p.m. Video Conference Committee Members: Rachelle Stinson (Chair) Matthew Abas (Vice Chair) Councillor John Gallo John Lenchak Hailey Reiss Jo-anne Spitzer Members Absent: Max Le Moine Other Attendees: Mat Zawada, Accessibility Advisor Ishita Soneji, Council/Committee Coordinator _____________________________________________________________________ 1. Call to Order The Chair called the meeting to order at 7 p.m. 1.1 Appointment of Chair and Vice Chair Moved by John Lenchak Seconded by Hailey Reiss 1. That Rachelle Stinson be appointed as Chair for Year 2022 of the Accessibility Advisory Committee (2018-2022 Term); and 2. That Matthew Abas be appointed as Vice Chair for Year 2022 of the Accessibility Advisory Committee (2018-2022 Term). Carried Page 1 of 59 2 2. Approval of the Agenda Moved by John Lenchak Seconded by Matthew Abas That the agenda as circulated by Legislative Services be approved. Carried 3. Declarations of Pecuniary Interest and General Nature Thereof There were no declarations of pecuniary interest under the Municipal Conflict of Interest Act, R.S.O. 1990, c. M.50. 4. Receipt of the Minutes 4.1 Accessibility Advisory Committee Meeting Minutes of December 8, 2021 Moved by Matthew Abas Seconded by John Lenchak That the Accessibility Advisory Committee Meeting Minutes of December 8, 2021, be received for information. Carried 5. Delegations None. 6. Matters for Consideration 6.1 Memorandum from Manager, Recreation; Re: SARC Gymnasium Addition - Project Update Lisa Warth, Manager, Recreation, presented an overview of the Stronach Aurora Recreation Complex (SARC) gym addition project noting the progress thus far and the community consultation process and outcomes. She further provided details of the preferred single gym design including the site layout, associated budget costs, and site-fit challenges. It was mentioned that the final design and site plans will be forthcoming. Page 2 of 59 3 Staff further provided an overview of the suggestions provided to the consultants and staff regarding accessibility such as proper acoustic features, universal washrooms, and other accessible features. The Committee inquired about the plan for accessible seating specifically for spectators and staff provided clarification. Moved by John Lenchak Seconded by Matthew Abas 1. That the memorandum regarding the SARC Gymnasium Addition – Project Update be received; and 2. That the Accessibility Advisory Committee comments regarding the SARC Gymnasium Addition – Project Update be received and referred to staff for consideration and further action as appropriate. Carried 6.2 Memorandum from Accessibility Advisor; Re: Site Plan Application SP-2021- 13 (Submission #1), 390 Addison Hall Circle Staff provided an overview of the site plan and any feedback submitted to the Planner on behalf of the Committee. The Committee and staff reviewed the site plan and suggested that more detail be provided regarding the washroom spaces and layout in future submissions. The Committee had no further input. Moved by Matthew Abas Seconded by Hailey Reiss 1. That the memorandum regarding Site Plan Application SP-2021-13 (Submission #1), 390 Addison Hall Circle, be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-13 (Submission #1) be received and referred to staff for consideration and further action as appropriate. Carried Page 3 of 59 4 6.3 Memorandum from Accessibility Advisor; Re: Site Plan Application SP-2021- 08 (Submission #3), 20 and 25 Mavrinac Boulevard Staff provided an overview of the site plan and comments submitted to the Planner on behalf of the Committee and the developer's response to previous comments. The Committee reviewed various aspects of the site plan and expressed concerns regarding the compromised exterior path of travel between Turp Drive and Hulse Way and lack of sidewalk connection from Yule Street onto Kane Street. The Committee suggested that these be taken into consideration to maintain continuous exterior path of travel around the block. Moved by Matthew Abas Seconded by John Lenchak 1. That the memorandum regarding Site Plan Application SP-2021-08 (Submission #3), 20 and 25 Mavrinac Boulevard, be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-08 (Submission #3) be received and referred to staff for consideration and further action as appropriate. Carried 6.4 Round Table Discussion; Re: Town of Aurora Accessibility Plan 2018 to 2024 Staff provided an update on the new Multi-Year Accessibility plan 2022- 2026 noting that it will be brought for Council's consideration to the February 15, 2022 General Committee meeting. Staff provided an overview of the upcoming projects planned for 2022 including: completion and finalization of the Aurora Seniors Centre ramp project and installation of wave operators; formation of employee resource groups to address accessibility concerns and deficiencies at Town facilities; completion of the first video of the accessibility video project; establishing a high school outreach program to create accessibility co-op positions; review parking and by-law policies to address accessible parking regulations; and installation of audible pedestrian signals at various intersections around Town. Page 4 of 59 5 Staff and the Committee further discussed about the accessibility work plan for the upcoming Municipal Elections in October. The Committee provided suggestions regarding accessibility at voting locations such as spaced-out voting tables for easy access for wheelchairs, seating/rest areas for those waiting in line, and availability of accessible materials to aid in voting if necessary. Staff noted more information and detailed elections accessibility work plan is forthcoming. Moved by Matthew Abas Seconded by Jo-anne Spitzer 1. That the Accessibility Advisory Committee comments regarding the Town of Aurora Accessibility Plan 2018 to 2024 be received and referred to staff for consideration and action as appropriate. Carried 7. Informational Items None. 8. Adjournment Moved by Hailey Reiss Seconded by Matthew Abas That the meeting be adjourned at 8:16 p.m. Carried Page 5 of 59 100 John West Way Aurora, Ontario L4G 6J1 (905) 727-3123 aurora.ca Town of Aurora Memorandum Corporate Services Re: Pre-Application Consultation PRE-2022-01, 375 Addison Hall To: Accessibility Advisory Committee From: Mateusz Zawada, Accessibility Advisor Date: March 9, 2022 Recommendation 1. That the memorandum regarding Pre-Application Consultation PRE-2022-01, 375 Addison Hall, be received; and 2. That the Accessibility Advisory Committee comments regarding Pre-Application Consultation PRE-2022-01 be received and referred to staff for consideration and further action as appropriate. Background The Accessibility Advisor has made comments on behalf of the Accessibility Advisory Committee. The following comments are conditions that must be met: Barrier-free parking shall be located on the shortest possible route, with minimal traffic flow crossing, to an accessible facility entrance. Barrier-free parking located next to the exit of the building is not on the shortest possible route. Please also note that there are new Design of Public Spaces (Built Environment) Standards enacted from the Province of Ontario, under the Accessibility for Ontarians with Disabilities Act and revisions to the Ontario Building Code to help standardize and encourage barrier free access. Attachments PRE-2022-01 Page 6 of 59 From:Punit, Rosanna To:Butler, Bill;Jean, Bill;Jakovina, Brian;Greidanus, Gary;Manoharan, Brashanthe;Van Scheyndel, Janet;Kazakoff, Nick;"developmentservices@york.ca";"Sara.Brockman@york.ca";"Abbas, Asif";"Trevor.Catherwood@york.ca"; "S.Filson@lsrca.on.ca";"Laura Tafreshi";"Dave Ruggle";"m.bessey@lsrca.on.ca";"prevention@cyfs.ca"; Colangelo, Luigi;Bat, Michael;Sample, Samantha;Zawada, Mat Cc:Hausz, Lisa;Henriques, Anna;"Kelly Nesbitt" Subject:CIRCULATION- Pre-Application Consultation -PRE-2022-01 - 375 Addison Hall Date:January 20, 2022 9:59:09 AM Attachments:2022.01.19 - application form.pdf 374 Addison Hall Circle - plans.pdf 375 Addison Hall SP PRE-checklist.docx MV-2021-25 - Notice of Decision.pdf Hello everyone, The Town is in receipt of a Pre-Application Consultation Request, as outlined below: File Number PRE-2022-01 Owner E. Manson Investments Limited Agent: Joanne Ying Address 375 Addison Hall Circle Proposal New one storey banquet hall, with mezzanine with a GFA of approximately 1,430m2 (15,393 ft2). 123 parking spaces provided Type of Application Required Major Site Plan Current zoning E-BP (443) Current Official Plan Designation Business Park Please review the attached materials and provide comments, to my attention, no later than Thursday February 3, 2022. Comments received via email will be incorporated into the Pre-Application Consultation Package and will be sent to the applicant. Note: A minor variance was approved last year, allowing a “banquet hall” as a permitted use and 123 parking spaces on the property (Committee of Adjustment Decision is attached – MV-2021-25). For Town of Aurora staff, I have attached the Pre-Consultation template for the required application types. Please feel free to provide your comments either in the attached template or in another manner convenient for you. Feel free to contact be if you have any questions, Thank you, Rosanna Punit Planner Town of Aurora 100 John West Way, Box 1000 Aurora, Ontario L4G 6J1 Phone: 905-727-3123 ext. 4347 rpunit@aurora.ca www.aurora.ca Attachments Page 7 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL (BLOCK 26)375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 19 2021SITE PLAN SK - 011 : 500(c) 2 0 1 5 T r a n s o f t S o l u t i o n s , I n c . All r i g h t s r e s e r v e d .Pumper Fire TruckNCHRP REPORT 659 (US)PPPPPPPFPFPFPFPFPFPFFOFOFOFOFOFOFOFOFOFOFOOOOiOiOiOiRRrRrRrRrRrRreReRTeTeTeTeTeTeTeT e6666T6T6T6T5T5(c)T5) 20T 5015T 5 TranT 5nsoftT 5T9 Solutior 9onsr 9,r9Incr 9 All..r9 rightu tsu reseuervedudu (.u(u(u(uUUcUcUcUcUcUccScSSkSkSkSkSkk)k)k)k)EPPL A N D S C A P E O P E N S P A C E3.0m5.3m5.3mL A N D S C A P E O P E N S P A C E3.0mL A N D S C A P E O P E N S P A C EA S P H A L T D R I V E W A YA S P H A L T D R I V E W A Y7.0m3.7m3.0m 21 P A R K I N G S P A C E S9 P A R K I N G S P A C E SOUTDOORWATERFEATURE(50 x 30)OUTDOORPATIO AREA(80 x 50)1 STOREY GLASSENCLOSURE(80 x 60)(97 x 56)1500TYPE ATYPE B ACCESSAISLE27003650TYPE A36501500ACCESSAISLEP O S S I B L E C O N C R E T E S I D E W A L KP O S S I B L E C O N C R E T E S I D E W A L KR 8.5mR 8.5m R 8.5m1.5m7.0m2.95m1.5m29725172291851918518247821.8m5.3m7.0mTYPICALTYPICALSTONE PAVER WALKWAYSTONE PAVERENTRY WAY1.5m±621577.0mTYPICAL2.7mTYPICAL16850INOUT7.0m(80 x 60)3.0m3.0m1.82mTYPICAL7.0m5.3m16 P A R K I N G S P A C E S10 P A R K I N G S P A C E S5.3mTYPICAL11 P A R K I N G S P A C E SSTONE PAVER WALKWAY8 P A R K I N G S P A C E S5.3m5.3m6 P A R K I N G S P A C E S7 P A R K I N G S P A C E SSTONE PAVER WALKWAY6 BICYCLE RACKOUTOUTMAINENTRYPOSSIBLETRANFORMER7 P A R K I N G S P A C E S7 P A R K I N G S P A C E S8 P A R K I N G S P A C E S4.4m18443TYPICAL2.7mTYPICALTYPICAL7.0m7.0mA S P H A L T D R I V E W A YA S P H A L T D R I V E W A YPROPOSED 1 STOREYBANQUET HALLWITH MEZZANINEOUTL O A D I N G A R E A1 L O A D I N G S P A C E(3.5m x 9.0m) A S R E Q' D1500TYPE ATYPE BACCESSAISLE27003650EARTH BINS (2)POSSIBLESNOW PILE STORAGE5 P A R K I N GS P A C E S10 P A R K I N G S P A C E SOUTOUT1.5m5.3m1.5m5.3m7 P A R K I N G S P A C E S5.3mTYPICALA D D I S O N H A L L C I R C L EBLOCK 25BLOCK 33BLOCK 33DATA :BUILDING COVERAGE = 1,600 m2 (18%)DRIVEWAY COVERAGE= 4,633.5 m2 (51%) LANDSCAPE COVERAGE= ± 2,851 m2 (31%) (including hard and soft landscaping, private patio, amenity terraces, stairs, ramps and raised landscape area)SITE AREA = ± 9,084.5 m2site area from survey prepared by Schaeffer Dzaldov Bennett Ltd.BUILDING FOOTPRINT :BANQUET HALL 1,600 m2PARKING REQUIREMENTS :11 PARKING SPACES PER 100 m2 GFAMV 2021-251 LOADING SPACE AND LOADING AREA PROVIDEDREGULAR PARKING SPACES REQUIRED : 123 SPACESBARRIER- FREE PARKING SPACES REQUIRED : 5 SPACES (TYPE A (3) + TYPE B (2)) TOTAL PARKING SPACES PROVIDED : 127 SPACES BARRIER- FREE PARKING SPACES PROVIDED : 5 SPACES (TYPE A (3) + TYPE B (2)) Lock to Lock TimeMSUWidthTrackSteering Angle0.806.50meters:::6.02.602.6040.1:10.00:37.8Steering Angle2.44 7.322.592.596.0Pumper Fire Truckmeters:::WidthTrackLock to Lock Time13.41VEHICLES LEGEND:Dec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 8 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL (BLOCK 26)375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 19 2021GROUND FLOOR PLANSK - 021 : 200POWERCOAT CHECKNEW134 ft2 (12 m2)GARBAGE ROOMNEW480 ft2 (45 m2)STORAGENEW89 ft2 (8 m2)SERVICE ROOMNEW127 ft2 (12 m2)KITCHENNEW628 ft2 (58 m2)EXIT CORRIDORSTORAGENEW276 ft2 (26 m2)UP1RUP19RBANQUET HALL 1NEW2,731 ft2 (254 m2)MENWASHROOMNEWWOMENWASHROOMNEWBANQUET HALL 2NEW4,800 ft2 (446 m2)OPEN AREANEW2,302 ft2 (214 m2)FRONT LOBBYNEW1,216 ft2 (113 m2)STAIRAABCDEFGHJKLMNOPQRMAIN ETNRYOUTDOOR PATIOOUTDOOR PATIOTOOUTDOORPATIOTOOUTDOORPATIOOUTOUTOUTELEVELEVATORMACHINEROOMNEW37 ft2 (3 m2)OUT54 x63 CLEAR LEVEL SPACEUP20ROUTWALK-INCOOLERNEW89 ft2 (8 m2)WALK-INFREEZERNEW89 ft2 (8 m2)KITCHENNEW771 ft2 (72 m2)60'-0"80'-0"60'-0"10'-0" OVERHEAD DOORUNIVERSALWASHROOMNEWOPEN STAIR (GLASS TREAD) TO MEZZANINE FLOORLIVE BAND AT MEZZANINE FLOORFLOOR AREAAREA per FLOOR ± 15,393 ft2 (±1,430 m2)WOMEN WASHROOMOPTION 2Dec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 9 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL (BLOCK 26)375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 19 2021MEZZANINE FLOOR PLANSK - 031 : 20060 x 36OFFICE #1NEW9' - 0" x 18' - 2"148 ft2 (14 m2)OFFICE #2NEW9' - 0" x 18' - 2"148 ft2 (14 m2)BOARD ROOMNEW11' - 0" x 18' - 2"201 ft2 (19 m2)BRIDAL SUITE #2NEW274 ft2 (25 m2)OPEN TO BELOWOPEN TO BELOWOPEN TO BELOWS T A F F C O R R I D O RDN20RABCDEFGHJKLMNOPQRPOSSIBLE LIVE BANDOPEN AREASLIDING DOORDN 20RSTAIRA60 x63 CLEAR LEVEL SPACEBRIDAL SUITE #1NEW280 ft2 (26 m2)COAT CHECKNEW113 ft2 (11 m2)40 ft2(4 m2)14 ft2(1 m2)14 ft2(1 m2)22 ft2(2 m2)25 ft2(2 m2)LIVE BAND AT MEZZANINE FLOOROFFICES AND BOARDROOMFLOOR AREAAREA per FLOOR ± 1,834 ft2 (±170 m2)(NOT INCLUDING STAIRS, ELEVATOR ANDOPEN STAIRS)Dec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 10 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 01 2021ADDISON HALL STREET FRONT ELEVATIONSK - 041 : 150FINISHED GROUND FLOORFINISHED MEZZANIE FLOORTOP OF ROOFU/S OF BOTTOM PLATE04.6613.549.94ARIADec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 11 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 01 2021INTERIOR REAR ELEVATIONSK - 051 : 150FINISHED GROUND FLOORFINISHED MEZZANIE FLOORTOP OF ROOFU/S OF BOTTOM PLATE04.6613.549.94Dec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 12 of 59 hj architects inc.85 forest crove courtaurora, ontariol3x 2l6416.628.2168416.887.6771info@hjarch.caBANQUET HALL375 ADDISON HALL CIRCLE, AURORA, ON.JY. OCTOBER , 2021; UPDATED DECEMBER 01 2021INTERIOR PATIO (SIDE) ELEVATIONSK - 061 : 150FINISHED GROUND FLOORFINISHED MEZZANIE FLOORTOP OF ROOFU/S OF BOTTOM PLATE04.6613.549.94Dec. 23, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 13 of 59 100 John West Way Aurora, Ontario L4G 6J1 (905) 727-3123 aurora.ca Town of Aurora Memorandum Corporate Services Re: Site Plan Application OPA-2021-03, ZBA-2021-03, SP-2021-07 (Submission #4), 15296 to 15314 Yonge Street To: Accessibility Advisory Committee From: Mateusz Zawada, Accessibility Advisor Date: March 9, 2022 Recommendation 1. That the memorandum regarding Site Plan Application OPA-2021-03, ZBA-2021-03, SP-2021-07 (Submission #4), 15296 to 15314 Yonge Street be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application OPA-2021-03, ZBA-2021-03, SP-2021-07 (Submission #4) be received and referred to staff for consideration and further action as appropriate. Background The Accessibility Advisor has made comments on behalf of the Accessibility Advisory Committee. The comments are as follows: No further comments at this time. The Accessibility Advisory Committee appreciates the opportunity to provide comments. Please also note that there are new Design of Public Spaces (Built Environment) Standards enacted from the Province of Ontario, under the Accessibility for Ontarians with Disabilities Act and revisions to the Ontario Building Code to help standardize and encourage barrier free access. Attachments OPA-2021-03 Page 14 of 59 From:Corr, Stephen To:Butler, Bill;Bat, Michael;Manoharan, Brashanthe;Terry, Edward;Jakovina, Brian;Colangelo, Luigi;Zawada, Mat;Cutler, Amanda;"Dave Ruggle";"Laura Tafreshi";"developmentservices@york.ca"; "Sara.Brockman@york.ca";"Mumtaz, Anwer";"CYFS-Planning@cyfs.ca";"sstein@cyfs.ca" Subject:4th Submission - 15296 to 15314 Yonge St - OPA/ZBA-2021-03 & SP-2021-07 Date:February 10, 2022 10:44:08 AM Attachments:image001.png Key_Map_OPA-2021-03_ZBA-2021-03_SP-2021-07_NEW.jpg 22-02-07 - Architectural & Site Plans.pdf Good Morning All, A 4th Submission has been made to Planning and Development Services for the above noted Official Plan Amendment, Zoning By-law Amendment and Site Plan applications to permit the development of a six-storey, 136- unit condominium apartment building at 15296, 15306 and 15314 Yonge Street. Attached for reference are a key location map and the site and elevation plans. All submission materials are available through the following Link. https://cityviewcanada.harriscomputer.com/PlansDrop/#/project-view/558 Login ID: Password: Please provide comments by Friday March 4th, 2022. Please let me know if you require any other information. Sincerely, -- Stephen Corr, MCIP, RPP, BES Senior Planner, Development Town of Aurora 100 John West Way, Box 1000 Aurora, Ontario L4G 6J1 Phone: 905-727-3123 ext. 4343 scorr@aurora.ca www.aurora.ca -- Attachments Page 15 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504 AVERAGE GRADE HAS BEEN CALCULATED AS PER THE DEFINITION IN THEONTARIO BUILDING CODE. Feb. 9, 2022DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED4SUBMISSION No.Page 16 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504Page 17 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504Page 18 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504Page 19 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504Page 20 of 59 15314 YONGE STREETAURORA, ONTARIOM2N 0G3 ICONARCHITECTS.CAT:416-224-0505 F:416-224-0504Page 21 of 59 NOTES:1:250PINE VALLEY DRIVESITEHAYHOE AVE.TMP-1LEGEND K.P.CHECKED BY:DESIGN BY:SCALE:PROJECT NO.DRAWING NO.DRAWN BY: K.P. G.R.NT 21-201DATE: DEC, 2021Suite 201, 520 Industrial Parkway South, Aurora ON L4G 6W8Tel: 416-274-7036, Fax: 877-957-2929Web: www.nextrans.caALIVE DEVELOPMENTS15314 YONGE STREET, AURORAWELLINGTON ST WWELLINGTON ST EALEX GARDNERCIRIRWIN AVECATHERINE AVECENTRE STYONGE STSITE Feb. 9, 2022DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED4SUBMISSION No.Page 22 of 59 !"#$$$% # &$ " ## #% # "# "#'( $# )) *" %" $$+#$$$$"" $),$ * % " * % )($ * * &$ $"%$ % ),$-$ * %&# (&)))"% #$$#$%$(**" %,() ./01234512566572582&95.0166&481065:.2;2;5&:0&<34&412108148=$;.=1665721065.=0&22&956&0=243581=>54.<.612.&0&<50/.0554.0/6&02502$) ")))% # % %# # # " " (" * ! % # % " " ' ! % ! % # # # # %" * # # # ## ! %# ! % # # % ! * %# # " % # # # ### # +)) #! % %* ### )$ %)+) # "))) # # " " % *" * *$ )+) # ### $ +)) #Feb. 9, 2022DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED4SUBMISSION No.Page 23 of 59 100 John West Way Aurora, Ontario L4G 6J1 (905) 727-3123 aurora.ca Town of Aurora Memorandum Corporate Services Re: Site Plan Application SP-2021-14 (Submission #1), 32 Don Hillock Drive To: Accessibility Advisory Committee From: Mateusz Zawada, Accessibility Advisor Date: March 9, 2022 Recommendation 1. That the memorandum regarding Site Plan Application SP-2021-14 (Submission #1), 32 Don Hillock Drive, be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-14 (Submission #1) be received and referred to staff for consideration and further action as appropriate. Background The following comments are conditions that must be met: Please note that the minimum number of barrier-free parking is 3 parking spaces for the use of persons with disabilities, which meets the requirements of the A.O.D.A Design of Public Spaces O.Reg 191/11, section 80.36 (4). Additional barrier-free parking spots to be located between Unit #1 and unit #2. Please note that where the number is an odd number, the number of parking spaces must be divided equally between parking spaces that meet the requirements of a Type A parking space and a Type B parking space, but the additional parking space, the odd-numbered space, may be a Type B parking space. O. Reg. 413/12, s. 6. Automatic door openers for all public access locations, including proper timed door delays. Installation of proper tactile indicators at the proposed staircases. For the proposed ramps: Page 24 of 59 Site Plan Application SP-2021-14 (Submission #1), 32 Don Hillock Drive March 9, 2022 Page 2 of 2 o Landings must be a minimum of 1,670 mm in length and at least the same width of the ramp for an in-line ramp. o Landings must have a cross slope that is not steeper than 1:50. The following comments are considerations: Consideration for emergency evacuation chairs to be provided at all staircase locations. Please also note that there are new Design of Public Spaces (Built Environment) Standards enacted from the Province of Ontario, under the Accessibility for Ontarians with Disabilities Act and revisions to the Ontario Building Code to help standardize and encourage barrier free access. Attachments SP-2021-14 Page 25 of 59 INTERNAL MEMORANDUM DATE:January 17, 2022 TO: CC: B.Butler, Planning and Development Services B.Jean, Building Division B.Jakovina, Parks Division M.Bat, Engineering & Capital Delivery Division E.Terry, Policy Planning J.Van Scheyndel, Legal Services B.Manoharan, Heritage Planning L.Colangelo, Public Works S.Corr, Planning and Development Services 0.=DZDGD,$FFHVVLELOLW\Coordinator Mayor and Members of Council L.Hausz, Acting Director of Planning and Development Services A.Henriques, Manager of Planning and Development Services Council Secretariat, Corporate Services FROM:Sean Lapenna, Planner Re: Site Plan Application 32 Don Hillock Drive File Number SP-2021-14 - First Submission ______________________________________________________________________ A first submission has been made to Planning and Development Services for the above noted site plan application to facilitate the development of a Single-Storey Multi-Unit Industrial Building. Due to file size restrictions, the majority of application materials have been uploaded through the following PlansDrop link: https://cityviewcanada.harriscomputer.com/PlansDrop/#/project-view/495 Please review this proposal and provide me with your comments and/or any recommended revisions that you may require by February 7, 2022. Should you have any questions regarding the above, please feel free to contact me. Regards, Sean Lapenna Planner Town of Aurora 100 John West Way Box 1000 Aurora, ON L4G 6J1 Phone:905-727-3123 Ext. 4346 Email: slapenna@aurora.ca www.aurora.ca Planning and Building Services Attachments Page 26 of 59 ,WHP'DWD0DWUL[3DUWRU2%&5HIHUHQFH)LUP1DPH&HUWLILFDWHRI3UDFWLFH1XPEHU$GGUHVV1DPHRI3URMHFW/RFDWLRQRI3URMHFW2QWDULR%XLOGLQJ&RGH;1$>$@VWRUH\LQGXVWULDO*5283)*5283);>$@ 3URMHFW'HVFULSWLRQ0DMRU2FFXSDQF\V%XLOGLQJ*)$Pð1XPEHURI6WRUH\V1XPEHURI6WUHHWV$FFHVV5RXWHV%XLOGLQJ&ODVVLILFDWLRQ6SULQNOHU6\VWHP3URSRVHG6WDQGSLSHUHTXLUHG)LUH$ODUPUHTXLUHG:DWHU6HUYLFH6XSSO\LV$GHTXDWH+LJK%XLOGLQJ3HUPLWWHG&RQVWUXFWLRQ$FWXDO&RQVWUXFWLRQ0H]]DQLQHV$UHDPð2FFXSDQWORDGEDVHGRQ%DUULHUIUHH'HVLJQ+D]DUGRXV6XEVWDQFHV3$573$57 3$571HZ$GGLWLRQ$OWHUDWLRQ&KDQJHRI8VH$ERYH*UDGH%HORZ*UDGH(QWLUH%XLOGLQJ%DVHPHQWDQG*URXS(2FFXSDQFLHV2QO\,Q/LHXRI5RRI5DWLQJ1RW5HTXLUHG<HV1R<HV 1R<HV 1R<HV 1R1RQ&RPEXVWLEOH%RWK&RPEXVWLEOH1RQ&RPEXVWLEOH %RWK&RPEXVWLEOHPð3HUVRQ'HVLJQRI%XLOGLQJ<HV1R([SODLQ<HV 1R=648$5(&2168/7,1*,1&3&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR77RURQWR2QWDULR0+%*RUGRQ%DNHU5RDG5HIHUHQFHVDUHWR'LYLVLRQ%XQOHVVQRWHG>$@IRU'LYLVLRQ$RU>&@IRU'LYLVLRQ&;;;;;;;;>$@ Pð1HZ7RWDO Pð([LVWLQJPð;7%'E\IXWXUHWHQGHQW VILWXSSHUPLW>$@ >$@>$@ 1$1$1$WR*URVV$UHDPð1HZ7RWDO Pð([LVWLQJPð>$@ >$@3OXPELQJ)L[WXUH5HTXLUHPHQWV5DWLR 0DOH)HPDOH ([FHSWDVQRWHGRWKHUZLVH)ORRU/HYHO$UHD2FFXSDQW/RDG)L[WXUHV5HTXLUHG)L[WXUHV3URYLGHG7%'E\IXWXUHWHQGHQW VILWXSSHUPLWP R O J E C TS C A L ED R A W NR E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP303&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR2%&0$75,; 6,7(67$7,67,&60U'LQJ7-1=$1R 'HVFULSWLRQ 'DWH ,VVXHGIRU63$ 2%&0$75,;$UHD6FKHGXOH*URVV%XLOGLQJ1DPH $UHD $UHD6)0( Pð 6)8QLW Pð 6)8QLW Pð 6)8QLW Pð 6)8QLW Pð 6)8QLW Pð 6)8QLW Pð 6)8QLW Pð 6)Pð 6)$UFKLWHFWXUDO'UDZLQJ/LVW6KHHW1XPEHU 6KHHW1DPH$ 2%&0$75,; 6,7(67$7,67,&6$ 6,7(3/$1$ *5281')/2253/$1$ 522)3/$1$ %8,/',1*(/(9$7,216$ %8,/',1*6(&7,216$ 0$66,1**UDQGWRWDO.(<3/$1/HV OL H 6W 'RQ+LOORFN'U:HOOLQJWRQ6W(6,7(Page 27 of 59 83838383838383838383PPP',$&21&670#PPP',$&21&670#PPP',$39&670#PPP',$39&670#PPP',$39&670#PPP',$39&670#P P P ',$39&670 #PPP',$&21&670#PPP',$&21&670#PPP',$&21&670#PPP',$&21&670#PPP',$&21&670#PPP',$&21&670#670ෘ723(,196,19670ෘ7236,19:,19670ෘ7236,19:,191,196707231:,19670723(,196707231,19670723(,196707231(,19670ෘ7236:,191,19(,19670ෘ723(,196(,191,19670ෘ723(,196,191,19670ෘ723(,19:,19670"""ෘ723:,19670"""ෘ723:,19670"""ෘ723:,19670ෘ723 %:7 :%:%:%:7&7&7&%:%:%:%:%:7 :7 :7 :7 :7&7&7&7&7&7&7:7 :7 :%:%:%:7&7&7&%:%:7&%:7&7&7&7&7&7&7&7&7&7&7&7&7&7&7&7&7&7&%:%:%:%:%:%:%:%:%:7:7&%:%:%:%:%:%:%:EX.STMCTRLMH3(1200ෘTOP:287.906,19EX12.7m-375mmDIAPVCSTM@1.50% (;(;(;(;(;(;(;(;(;(;(;(; (;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;(;[P$'6VWRUPWDQNFKDPEHURSHQERWWRPGHSWKRIFKDPEHUPVWRUDJH PñERWWRPRIFKDPEHU 5 7<3&7<3%5(7$,1,1*:$//:*8$5'5$,/0(81,781,781,781,781,781,781,7(;,67,1*),5(+<'5$177<37<3 7<3($ 7<3(%5(7$,1,1*:$//5(7$,1,1*:$//75$16)250(56,$0(6(&211(&7,215(7$,1,1*:$//:(676(7%$&.%8,/',1*)5217$*(($676(7%$&.)52176(7%$&.%8,/',1*/(1*7+5($56(7%$&./27)5217$*('21+,//2&.'5,9(3523(57</,1(3523(57</,1(3523(57</,1(3523(57</,1(/27'(37+67$1'$5'3$5.,1*67$1'$5'3$5.,1*%$55,(5)5((3$5.,1*),5(5287(),5(5287(),5(5287(55(7$,1,1*:$//&85%5$03/$1'6&$3,1*675,3/$1'6&$3,1*675,3/$1'6&$3,1*675,3 7<3&7<3%7<3&7<3%7<3&7<3%7<3&7<3%7<3&7<3%7<3&7<3%3</216,*167((/*8$5'5$,/,1*3$5.,1*127(6 0,1,0803$5.,1*63$&(6,=(681/(6627+(5:,6(127('PP:,'(;PP/21*126,'(62%6758&7('PP:,'(;PP/21*21(6,'(2%6758&7('PP:,'(;PP/21*7:26,'(2%6758&7(' 0$,17$,10,1,080'5,9($,6/(:,'7+2)PP81/(6627+(5:,6(127(' 0$,17$,10,1,080+($'5220&/($5$1&(2)PP7+528*+287/2&$7(6,*1$77+(&(175(2)($&+63$&(%)3$5.,1*7<3($/2&$7(6,*1$77+(&(175(2)($&+63$&(%)3$5.,1*7<3(%67$1'$5'3$5.,1*3$5$//(/3$5.,1*%,.(3$5.,1*/2$',1*63$&(7<3(%/;:;+/2$',1*63$&(7<3(&/;:;+P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP30$VLQGLFDWHG3&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR6,7(3/$10U'LQJ7-1=$6,7(3/$11R 'HVFULSWLRQ 'DWH ,VVXHGIRU&RRUGLQDWLRQ ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ Page 28 of 59 8383838383838383838383838383838383$%&'(]\([Pð81,7Pð81,7Pð81,7Pð81,7Pð81,7Pð0(Pð81,7Pð81,7]\[]\[]\[]\[]\[]\[(((((($$5(7$,1,1*:$//5(7$,1,1*:$//&85%5$037<3($ 7<3(%67$1'$5'3$5.,1*%$55,(5)5((3$5.,1*)/225'5$,15($,1,1*:$//*8$5'5$,/P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP303&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR*5281')/2253/$10U'LQJ7-1=$*5281')/2251R 'HVFULSWLRQ 'DWH ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ Page 29 of 59 $%&'(]\([)/$7522))8785(522)72381,7)8785(522)72381,7)8785(522)72381,7)8785(522)72381,7)8785(522)72381,7)8785(522)72381,7)8785(522)72381,7)8785(522)72381,7]\[]\[]\[]\[]\[]\[(((((($$>1R6ORSH@>1R6ORSH@>1R6ORSH@6&833(5PP$%29(522)),1,6+522)'5$,1522)'5$,1522)'5$,1522)'5$,1522)'5$,1522)'5$,1522)'5$,1522)'5$,16&833(5PP$%29(522)),1,6+6&833(5PP$%29(522)),1,6+6&833(5PP$%29(522)),1,6+P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP303&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR522)3/$10U'LQJ7-1=$522)3/$11R 'HVFULSWLRQ 'DWH ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ 127(522)72381,7/2&$7,215()(5720(3'5$:,1*Page 30 of 59 *5$'(*5281')/2257232)522)7232)3$5$3(7%8,/',1*+(,*+73&3&*$*$6363$*$&63636363*5$'(*5281')/225$%&'(7232)522)7232)3$5$3(7%8,/',1*+(,*+7 3&&$*5$'(*5281')/225%8,/',1*+(,*+77232)522)7232)3$5$3(73&&3737$*5$'(*5281')/225$%&'(%8,/',1*+(,*+77232)522)7232)3$5$3(73&3&*$&37$&3&6,$0(6(&211(&7,2163373$,17&2/25373$,17&2/256363$1'52*$*/$=,1*3&35(&$67&21&5(7(3&35(&$67&21&5(7(&&21&5(7(),1,6+,1*;36P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP30$VLQGLFDWHG3&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR%8,/',1*(/(9$7,2160U'LQJ7-1=$($67(/(9$7,211257+(/(9$7,21:(67(/(9$7,216287+(/(9$7,211R 'HVFULSWLRQ 'DWH ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ Page 31 of 59 *5$'(*5281')/2257232)522)7232)3$5$3(7$0(81,781,781,781,781,781,781,7%8,/',1*+(,*+7 *5$'(*5281')/225$%&'(7232)522)7232)3$5$3(7$0( 81,7%8,/',1*+(,*+7 P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP303&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR%8,/',1*6(&7,2160U'LQJ7-1=$1R 'HVFULSWLRQ 'DWH ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ %8,/',1*6(&7,21%8,/',1*6(&7,21Page 32 of 59 13$5.,1*/2781,76,1'8675,$/%8,/',1*5(7$,1,1*:$///2$',1*63$&(3$5.,1*/270$,1(175$1&(65(7$,1,1*:$//%$55,(5)5((5$030(5220(175$1&(5(7$,1,1*:$//3523(57</,1(/$1'6&$3,1*675,36/$1'6&$3,1*6,'(:$/.6,'(:$/.3</216,*1P R O J E C T S C A L E D R A W N R E V I E W E DI S S U E R E C O R DR E V I S I O N R E C O R DNote: This drawing is the property of the Architect and may not be reproduced orused without the expressed consent of the Architect. The Contractor is responsiblefor checking and verifying all levels and dimensions and shall report alldiscrepancies to the Architect and obtain clarification prior to commencing work.IRU=648$5(&2168/7,1*,1&*25'21%$.(55'1257+<25.217$5,20+%LQIR#]VTXDUHFRQVXOWLQJFRP303&,* 7LJHU'RQ+LOORFN'U$XURUD2QWDULR0$66,1*0U'LQJ7-1=$1R 'HVFULSWLRQ 'DWH ,VVXHGIRU5HYLHZ ,VVXHGIRU63$ $;2120(75,&9,(:'9,(:)5217'9,(:5($5Page 33 of 59 UNIT #1FFE=290.00UNIT #2FFE=290.35UNIT #3FFE=290.70UNIT #4FFE=290.70UNIT #5FFE=290.70UNIT #6FFE=290.70UNIT #7FFE=290.70290.45290.50290.47290.50290.55290.45290.70290.52290.50290.50291.88292.15292.00290.55289.64289.62290.70289.30289.25289.35289.25289.35289.20289.35289.28289.40288.90289.05288.50288.70289.08289.20288.78288.34288.12288.40288.64289.50290.11289.50289.50289.50289.50289.50( T W)289.50289.48289.13289.50289.50289.50289.50289.50289.15288.80288.80290.68290.35290.00291.70290.70290.705.0%2.5%0.6%0.6%0.6%1.6%4.2%5.0%1.0%5.0%1.0%5.0%1.0%2.0%2.1%1.4%2.0%2.8%1.4%2.1%1.6%1.4%1.3%1.5%1.5%1.9% 1.4%2.1%289.502.8%291.83288.801.3%1.8%4.8%1.4%1.4%2.0%4.1%2.7%4.4%5.6%289.152.4%290.05(BW)290.00290.35290.70290.70290.70290.70290.70290.65(BW)290.35(BW)290.35290.65(TC)290.50290.65(TC)290.50290.65(TC)292.06291.99292.35292.441.0%1.0%1.0%1.5%1.0%4.0%290.84290.58289.60288.7 4( B W) 288.8 0( B W) 289.09( B W) 289.1 5( B W) 289.5 0( B W) 289.39( T W) 289.09( T W) 289.04( T W) 288.74( T W)4.3%5.0%1.5%3.8%4.9%1.0%5.0%287.82288.56287.64(TC)288.52(TC)291.95(TC)292.02(TC)292.31(TC)292.38(TC)1.5%1.3%1.2%PROPOSED RETAINING WALLMAX HEIGHT = 0.24mPROPOSED RETAINING WALLMAX HEIGHT = 0.24mPROPOSED RETAINING WALL &GUARDRAIL. WALL HEIGHT TO BEAS PER STRUCTURAL ENGINEER291.22(TW)PROP. AREA DRAIN(BY ARCH/MECH)290.96289.93290.00290.70PROPOSED RETAINING WALLMAX HEIGHT = 3.00m289.505.0m WIDESTORMEASEMENT5.0m WIDE HYDRO EASEMENT 6.85m WIDESTORM EASEMENTPROPOSED EXPOSED FOUNDATIONMAX HEIGHT = 1.05mPROPOSED EXPOSED FOUNDATIONMAX HEIGHT = 0.35mPROPOSED EXPOSED FOUNDATIONMAX HEIGHT = 0.35mPROPOSED EXPOSEDFOUNDATIONMAX HEIGHT = 1.20m5.0%289.24( T W) 288.90( T W)290.00(BW)291.41(BW)289.65(TC)289.79290.501.3%4.0%290.502.9%291.72291.64291.87(TC)5.0%1.2%289.90289.941.7%1.7%1.2%289.80288.95289.00289.85290.00291.79(TC)291.82290.10290.00(BW)288.80291.68(BW)290.65(TC)290.35(BW)3.2%4.6%3.6%0.6%0.6%0.6%2.1%3.0%289.88(TC)290.85(TC)290.69(TC)290.60(TC)290.70(TC)290.65(TC)290.73(TC)292.30(TC)290.85(TC)289.75(TC)289.45(TC)289.25(TC)289.30(TC)289.23(TC)289.15(TC)289.05(TC)288.85(TC)288.49(TC)291.17(BW)291.82(BW)292.14(BW)292.21(BW)292.05(BW)291.90(BW)292.00(BW)291.95(BW)291.075.0%4.5%4.5%5.0%290.00(BW)291.45291.60(TW)291.50291.584.5%292.24(TC)PROPOSED BURIED FOUNDATIONMAX HEIGHT = 1.90m293.53(BW)292.03(BW)290.75(BW)291.04(BW)290.74(BW)292.88(BW)2.0%4.4%MAX 2:1SLOPEMAX 2:1SLOPEMAX 2:1SLOPEMAX 2:1 SLOPE MAX 2:1 SLOPE MAX 2:1SLOPEMAX 3:1SLOPE0.6%292.14(BW)2.3%2.3%290.70DON HILLOCK DRIVEEX. STM CTRL MH3 (1200TOP:287.90OGS2 (FD-4HC) (1200TOP:288.13STM MH5 (1800TOP:288.41STM MH6 (1200TOP:288.86OGS 1 (FD-4HC) (1200TOP:289.13STM MH1 (1200TOP:289.28STM MH2 (1200TOP:290.63STM MH3 (1200TOP:290.40CB4TOP:288.75DCB1TOP:289.00CB3TOP:289.10CB2TOP:290.35CB1TOP:290.35SAN MH1 (1200TOP:288.50SAN CTRL MH6A (1200TOP:287.99EXISTING BARRIER CURB AND GUTTER TO BE REMOVEDAND REPLACED WITH DEPRESSED CURB. MILL MINIMUM 300mm OFEXISTING TOP COAT ASPHALT AND MATCH TO EXISTING USINGSTEP JOINT. REFER TO STEP JOINT DETAIL ON THIS SHEETEXISTING BARRIER CURB AND GUTTER TO BE REMOVEDAND REPLACED WITH DEPRESSED CURB. MILL MINIMUM 300mm OFEXISTING TOP COAT ASPHALT AND MATCH TO EXISTING USINGSTEP JOINT. REFER TO STEP JOINT DETAIL ON THIS SHEETSTM MH8 (1200TOP:289.44290.502.8%289.73MAX 2:1SLOPEMAX 2:1SLOPE288.88(TC)PROPOSED 1.0m WIDECURB CUT288.73(SW)4.7%STM MH7 (1200TOP:289.222.0%1.3%1.9%1.9%1.1%3.1%PROP.TRANSFORMER PADELEV=+/-288.900.7%PROP. PAD WALLMAX HEIGHT=0.70m2.3%10.7%1.7%1.7%1.2%0.4%4.2%1.1%290.47290.65290.62290.531.5%1.7%289.24(TC)MAX 3:1 SLOPEPROP. AREA DRAIN(BY ARCH/MECH)AADICB1TOP:287.98EXTENT OF AREA WITHMAX 2:1 SLOPEEXTENT OF AREA WITHMAX 3:1 SLOPEEXTENT OF AREA WITHMAX 2:1 SLOPE288.90(TC)288.90(TC)STAIRS C/W RAILINGS.REFER TO ARCH.DRAWINGSPROPOSED PAVEMENT ELEVATIONPROPOSED TOP OF CURB ELEVATIONPROPOSED TOP OF WALL ELEVATIONPROPOSED BOTTOM OF WALL ELEVATIONPROPOSED ELEVATION TO MATCH EXISTING ELEVATIONPROPOSED STORM MANHOLE (SIZE AS SHOWN)PROPOSED STORM CATCHBASIN MANHOLE (SIZE AS SHOWN)PROPOSED CATCHBASINPROPOSED DOUBLE CATCHBASINEXISTING STORM MANHOLEEXISTING STORM CATCHBASIN MANHOLEEXISTING CATCHBASINEXISTING DOUBLE CATCHBASINPROPOSED SANITARY MANHOLE (SIZE AS SHOWN)EXISTING SANITARY MANHOLEPROPOSED VALVE AND BOXPROPOSED SIAMESE CONNECTIONEXISTING HYDRANTEXISTING VALVE AND BOXEXISTING CONTOURREMOVAL ITEMPROPOSED AREA DRAINPROPOSED BOTTOM OF SWALELEGEND291.64291.65(TC)291.60(TW)292.00(BW)STEP JOINT40TOP ASPHALTBASE ASPHALTEXISTING PAVEMENT300 MIN.TACK COATSAWCUT EXISTING ASPHALT EDGETO PROVIDE CLEAN VERTICAL JOINTMILL OFF 40mm OF EXISTING ASPHALTAND REPLACE AS PER SPECIFICATIONSRUBBERIZED ASPHALT SEALANT (McASPHALTBERAM 3060 LM EXTRA LOW MODULUS ORAPPROVED EQUIVALENT)CHECKED BY:BCDRAWN BY:BC2PROJECT No:2159432 DON HILLOCK DRIVEINDUSTRIAL DEVELOPMENTAURORA, ONTARIODESCRIPTION#REVISIONBLOCKDATE1. 12/01/21 ISSUED FOR SPAMETRIC SCALENORTH ARROWWELLINGTONST EASTLESLIE STERIC TSMITH WAYDONHILLOCK DRHWY 404SITEKEY PLANN.T.SSGPSITE GRADING PLAN07.5Metres1:250GENERAL NOTES1. ALL WORK WITHIN THE TOWN RIGHT-OF-WAY SHALL BE CONSTRUCTED ACCORDING TO THE LATEST TOWN OF AURORA STANDARDDRAWINGS AND SPECIFICATIONS. ONTARIO PROVINCIAL STANDARD DRAWINGS AND SPECIFICATIONS MAY, SUBJECT TO THE APPROVAL OFTHE TOWN OF AURORA BE USED WHERE NO TOWN STANDARD OR SPECIFICATION IS AVAILABLE.2. ALL WORK SHALL BE COMPLETED ACCORDING TO THE CURRENT OCCUPATIONAL HEALTH AND SAFETY ACT AND REGULATIONS FORCONSTRUCTION PROJECTS. THE GENERAL CONTRACTOR SHALL BE DEEMED TO BE THE CONSTRUCTOR AS DEFINED IN THE ACT.3. ALL MATERIALS FOR SEWER, WATERMAIN, HYDRANTS AND APPURTENANCES, SHALL BE ACCORDING TO TOWN OF AURORA'S ACCEPTABLEPRODUCTS LIST IN THE STANDARD CONTRACT DOCUMENTS FOR MUNICIPAL CONSTRUCTION.4. ALL SURVEY STAKE LAYOUT POINTS SHALL BE VERIFIED IN THE FIELD BY THE CONTRACTOR PRIOR TO CONSTRUCTION. ANYDISCREPANCIES BETWEEN THE DRAWINGS AND THE LAYOUT SHALL BE IMMEDIATELY REPORTED TO THE ENGINEER.5. ALL DIMENSIONS ARE EXPRESSED IN METERS(m) AND PIPE SIZES ARE EXPRESSED IN MILLIMETERS (mm) UNLESS OTHERWISE NOTED.6. ALL TEMPORARY CONSTRUCTION FENCING, TRAFFIC CONTROL AND SIGNAGE DURING CONSTRUCTION (INCLUDING ALL NECESSARYSIGNALS, SIGNS, DELINEATORS, MARKERS AND BARRIERS) SHALL BE IN ACCORDANCE WITH CURRENT ONTARIO TRAFFIC MANUAL BOOK 7:TEMPORARY CONDITIONS FIELD EDITION.7. INFORMATION REGARDING ALL EXISTING UNDERGROUND UTILITIES AND SERVICES SHOWN ON THE DRAWINGS IS BASED ON INFORMATIONPROVIDED BY OTHERS AND/OR AVAILABLE HISTORICAL DRAWINGS. THE ACCURACY OF THIS INFORMATION HAS NOT BEEN CONFIRMED BYKWA SITE DEVELOPMENT CONSULTING AND ALL UNDERGROUND INFORMATION NEEDS TO BE VERIFIED IN THE FIELD PRIOR TO BIDDING ANDCONSTRUCTION. THE CONTRACTOR IS RESPONSIBLE TO ACQUIRE ALL UTILITY LOCATES PRIOR TO CONSTRUCTION AND TO NOTIFY THEENGINEER OF ANY DISCREPANCIES. ANY LOST TIME DUE TO FAILURE TO IDENTIFY DISCREPANCIES OR NOTIFY THE ENGINEER SHALL BE ATTHE CONTRACTOR'S EXPENSE. THE CONTRACTOR WILL BE RESPONSIBLE FOR ANY DAMAGE TO EXISTING INFRASTRUCTURE.8. THE CONTRACTOR IS RESPONSIBLE TO COORDINATE ALL REQUIRED INSPECTIONS WITH THE TOWN OF AURORA AND ANY OTHERREGULATORY AGENCIES. ALL WORK ON TOWN EASEMENTS OR RIGHT-OF-WAY AND ALL WATERMAIN WORK SHALL BE INSPECTED BY THETOWN PRIOR TO BACKFILLING. TOWN OF AURORA INFRASTRUCTURE AND ENVIRONMENTAL SERVICES DEPARTMENT - 905-727-13759. CONTRACTOR IS RESPONSIBLE TO SUPPLY AND INSTALL ALL NECESSARY CONSTRUCTION FENCING.10. THIS DRAWING SET SHOULD BE READ IN CONJUNCTION WITH ALL OTHER CONSULTANT'S PLANS AND ANY DISCREPANCIES REPORTED TOTHE ENGINEER PRIOR TO CONSTRUCTION.11. ALL DIMENSIONS SHALL BE CHECKED AND VERIFIED IN THE FIELD BY THE CONTRACTOR PRIOR TO ANY CONSTRUCTION AND ANYDISCREPANCIES REPORTED TO THE ENGINEER.12. NO SUBSTITUTIONS SHALL BE ALLOWED WITHOUT ENGINEERS APPROVAL AND ACCEPTANCE BY THE TOWN OF AURORA13. ALL DISTURBED AREAS ON PRIVATE LANDS SHALL BE REPAIRED TO ORIGINAL CONDITION OR BETTER AND TO THE SATISFACTION OF THEENGINEER. WITHIN TOWN RIGHT-OF-WAY AND EASEMENTS, REPAIRS TO ORIGINAL CONDITION OR BETTER MUST BE TO THE SATISFACTIONOF THE TOWN OF AURORA.14. THE CONTRACTOR IS ADVISED THAT WORKS AND OPERATIONS BY OTHERS MAY BE ONGOING AT THE SAME TIME AS THIS CONTRACT. THECONTRACTOR SHALL COORDINATE CONSTRUCTION ACTIVITIES AND PREVENT CONSTRUCTION CONFLICTS.15. THE CONTRACTOR IS RESPONSIBLE FOR OBTAINING AND PAYING FOR ALL PERMITS INCLUDING ROAD OCCUPANCY PERMITS AND THIRDPARTY UTILITY COSTS.16. THE CONTRACTOR IS TO PROVIDE A WEEKLY REDLINE AS-BUILT SURVEY TO THE ENGINEER FOR REVIEW. AS-BUILT TO SHOW PIPEALIGNMENT AND INVERT, PIPE SIZE, PIPE MATERIAL, MAINTENANCE HOLES, HYDRANTS, VALVES AND BENDS.17. THE CONTRACTOR IS TO PROVIDE AN AS-BUILT SURVEY OF COMPLETED SERVICING AND GRADING WORKS, INCLUDING INVERTS, ALL ABOVEGROUND WORKS, AND SPOT ELEVATIONS AT A MAXIMUM 10m GRID INTERVAL. ALL ABOVEGROUND ITEMS, INCLUDING CURBS, SIDEWALKS,WALLS, BUILDING APRONS, STAIRS, ETC. TO INCLUDE ADEQUATE SPOT ELEVATIONS TO CONFIRM DESIGN INTENT (IE. DRAINAGE AROUNDCURBED ISLANDS, TOP & BOTTOM OF CURB, SHOTS ON EACH RISER, ETC.). SURVEY TO BE PREPARED BY LICENSED ONTARIO LANDSURVEYOR.18. THE CONTRACTOR IS RESPONSIBLE TO INSTALL AND MAINTAIN EROSION AND SEDIMENT CONTROLS AS REQUIRED BY THIS CONTRACT ANDTOWN AND PROVINCIAL STANDARDS.GRADING1. ALL SUBGRADE, GRANULAR MATERIALS, AND COMPACTION REQUIRED ARE TO BE AS PER GEOTECHINCAL REPORT. THE CONTRACTOR IS TOENSURE THAT THE GEOTECHNICAL CONSULTANT WITNESSES THE PROOF-ROLL AND GIVES APPROVAL TO PROCEED FORWARD. ANY SOFTSPOTS IDENTIFIED WILL BE CORRECTED BY THE CONTRACTOR BASED UPON GEOTECHNICAL RECOMMENDATIONS IN THE FIELD. ADDITIONALCOSTS FOR REMEDIAL WORK MUST BE APPROVED BY THE ENGINEER PRIOR TO PROCEEDING. THE CONTRACTOR IS RESPONSIBLE FORCOORDINATION OF ALL INSPECTIONS.2. ANY POTENTIAL RE-USE TO BE IN ACCORDANCE WITH GEOTECHNICAL RECOMMENDATIONS AND APPROVAL.3. GRADES TO MEET EXISTING OR PROPOSED ELEVATIONS SHALL BE AT 3:1 SLOPE OF FLATTER UNLESS OTHERWISE NOTED.4. ALL TREE AND SHRUB RELOCATION SHALL BE IN ACCORDANCE WITH THE LANDSCAPE PLANS.5. ALL ITEMS FOR REMOVAL SHALL BE TAKEN AWAY FROM SITE AND DISPOSED OF AT AN APPROVED DISPOSAL FACILITY.6. ALL DISTURBED AREAS TO BE REINSTATED TO ORIGINAL CONDITION OR BETTER.7. ALL GUARDRAILS, RISERS, AND RETAINING WALLS AS PER ARCHITECTURAL DRAWINGS.8. DIMENSIONS AND LOCATION OF ALL RAMPS, PAINTED LINES, WALKWAYS, SIDEWALKS, CURBS, CONCRETE PADS, AND ISLANDS SHALL BE TAKENFROM THE SITE PLAN.9. UNLESS OTHERWISE STATED, ALL CURB WITHIN THE SCOPE OF WORKS TO BE BARRIER CURB (0.15m HIGH) AS PER OPSD 600.110.10. UNLESS OTHERWISE STATED, ALL CURB AND GUTTERS WITHIN THE RIGHT OF WAY ENTRANCE AREA TO BE AS PER OPSD 600.040.11. SAW CUT EXISTING PAVEMENT, SIDEWALK, CURB, GUTTER, DRIVEWAYS, WALKWAYS, ETC. AT CONSTRUCTION LIMITS TO PROVIDE A CLEAN JOINTFOR THE PROPOSED WORK.12. PAVEMENT STRUCTURES TO BE AS PER, "PRELIMINARY GEOTECHNICAL INVESTIGATION REPORT" PREPARED BY GOLDER ASSOCIATES LTD.,DATED NOVEMBER 11, 2021:LIGHT-DUTY TRAFFIC AREAS40mm HL3 ASPHALTIC CONCRETE (OPSS 1150)50mm HL8 ASPHALTIC CONCRETE (OPSS 1150)150mm GRANULAR "A" BASE (OPSS 1010)300mm GRANULAR "B" TYPE II SUBBASE (OPSS 1010)HEAVY-DUTY TRAFFIC AREAS50mm HL3 ASPHALTIC CONCRETE (OPSS 1150)80mm HL8 ASPHALTIC CONCRETE (OPSS 1150)150mm GRANULAR "A" BASE (OPSS 1010)450mm GRANULAR "B" SUBBASE (OPSS1010)0.15m1.03mPROP. RETAINING WALLFFE=290.35290.07PAVEMENTGRANULAR LAYERSUBGRADEUNIT #2BOTTOM OF WALLELEV = 290.07TOP OF WALLELEV = 291.51PAVEMENTELEV = 291.36CROSS SECTION A - AN.T.S.TOPOGRAPHIC SURVEY PROVIDED BY ERTL SURVEYORS, DATED MARCH 17, 2021.ELEVATIONS HEREON ARE GEODETIC AND DERIVED FROM TOWN OF AURORA.BM NO. 489-69 ELEVATION = 300.794mSITE PLAN PROVIDED BY Z SQUARE CONSULTING INC., DATED OCTOBER 20, 2021.GUARDRAIL. REFER TOARCHITECTURAL PLANSPage 34 of 59 100 John West Way Aurora, Ontario L4G 6J1 (905) 727-3123 aurora.ca Town of Aurora Memorandum Corporate Services Re: Site Plan Application SP-2021-15 (Submission #1), 420 Addison Hall Circle To: Accessibility Advisory Committee From: Mateusz Zawada, Accessibility Advisor Date: March 9, 2022 Recommendation 1. That the memorandum regarding Site Plan Application SP-2021-15 (Submission #1), 420 Addison Hall Circle, be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application SP-2021-15 (Submission #1) be received and referred to staff for consideration and further action as appropriate. Background The following comments are conditions that must be met: Please note that the minimum number of accessible parking spaces is 6 parking spaces for the use of persons with disabilities, which meets the requirements of the AODA Design of Public Spaces O.Reg 191/11, section 80.36 (4). Barrier-free parking spots to be evenly distributed amongst buildings to create the shortest possible accessible route to the barrier-free entrances. Exterior path of travel (walkway) to have a minimum clear width of 1,500 mm. Automatic door openers for all public access locations, including proper timed door delays. Please also note that there are new Design of Public Spaces (Built Environment) Standards enacted from the Province of Ontario, under the Accessibility for Ontarians with Disabilities Act and revisions to the Ontario Building Code to help standardize and encourage barrier free access. Page 35 of 59 Site Plan Application SP-2021-15 (Submission #1), 420 Addison Hall Circle March 9, 2022 Page 2 of 2 Attachments SP-2021-15 Page 36 of 59 From:Punit, Rosanna To:Butler, Bill;Jean, Bill;Sample, Samantha;Greidanus, Gary;Colangelo, Luigi;Cutler, Amanda; "prevention@cyfs.ca";Zawada, Mat;Van Scheyndel, Janet;Kazakoff, Nick;Bat, Michael Cc:Henriques, Anna;Hausz, Lisa;Manoharan, Brashanthe Subject:CIRCULATION - 420 Addison Hall Circle - SP 2021-15 - 1st submission Date:January 17, 2022 4:30:23 PM Attachments:420 Addison Hall Circle - Arch Rev 6.pdf Hello everyone, A Site Plan application (SP 2021-15) has been received for 420 Addison Hall Circle. The proposal is for a new 70,719 sq ft (6,570 m2) multi unit industrial building, with 139 parking spaces. Here is the link to the documents/reports for review, using the log on and password below: https://cityviewcanada.harriscomputer.com/PlansDrop/#/project-view/496 Username: Password: Please let me know if you have any trouble accessing the link. Appreciate receiving comments by Tuesday February 8, 2022. If additional time is needed, please let me know in advance. If you have any questions feel free to contact me. Thank you, Rosanna Rosanna Punit Planner Town of Aurora 100 John West Way, Box 1000 Aurora, Ontario L4G 6J1 Phone: 905-727-3123 ext. 4347 rpunit@aurora.ca www.aurora.ca Attachments Page 37 of 59 AS-BUILT ELEVATION *LEGENDJuly 14, 2019SCALE: 1:1000PLOT TO 36"X48" FOR PROPER SCALE*2019 Year end survey by VujevaSurveysBLOCK 1BLOCK 18BLOCK 29BLOCK 33BLOCK 19BLOCK 14BLOCK 7BLOCK 2BLOCK 3BLOCK 4BLOCK 32BLOCK 35BLOCK 34BLOCK 27BLOCK 26BLOCK 15BLOCK 5BLOCK 6BLOCK 8BLOCK 9BLOCK 31BLOCK 30BLOCK 28BLOCK 20BLOCK 13BLOCK 34BLOCK 39(0.30 RESERVE)BLOCK 37(0.3m RESERVE)BLOCK 10BLOCK 16BLOCK 17BLOCK 12BLOCK 11BLOCK 21BLOCK 22BLOCK 23BLOCK 25BLOCK 33BLOCK 36(STREET WIDENING)ADADAD297.50298.50298.00301.50300.00299.50302.00301.50299.50300.50299.50300.50299.50300.00299.50300.00 AD299.00 ADADADADADADADADADADADADADADADAD ADADADADADADADADADADADADBLOCK 36(STREET WIDENING)BLOCK 38(0.30 RESERVE)BLOCK 24299.0018.6 39.6ADADAD CO AD ADADCOADADADADAD AD ADAD ADADADADADADADADADADADADAD ADAD ADADADCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCO COCOCOCOCO CO CO CO CO COADADADADADADCOCODecember 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 38 of 59 - 420 ADDISON HALL CIRCLE -SCALE: 1:300PROPOSED SITE PLANBLDG AFUTURESTORAGESNOWEXPANSIONAREA97.856 mN 71° 24' 50" EADDISON HALL CIRCLE197.856 mN 71° 24' 50" E100.000 mN 71° 24' 50" E96.700 mN 18° 35' 10" W96.700 mN 18° 35' 10" W243759NA00Proposed newIndustrial BuildingxxxxAS-BUILT ELEVATION *LEGENDJuly 14, 2019SCALE: 1:1000PLOT TO 36"X48" FOR PROPER SCALE* 2019 Year end survey by VujevaSurveysBLOCK 1BLOCK 18BLOCK 29BLOCK 33BLOCK 19BLOCK 14BLOCK 7BLOCK 2BLOCK 3BLOCK 4BLOCK 32BLOCK 35BLOCK 34BLOCK 27BLOCK 26BLOCK 15BLOCK 5BLOCK 6BLOCK 8BLOCK 9BLOCK 31BLOCK 30BLOCK 28BLOCK 20BLOCK 13BLOCK 34BLOCK 39(0.30 RESERVE)BLOCK 37(0.3m RESERVE)BLOCK 10BLOCK 16BLOCK 17BLOCK 12BLOCK 11BLOCK 21BLOCK 22BLOCK 23BLOCK 25BLOCK 33BLOCK 36(STREET WIDENING)ADADAD297.50 298.50298.00301.50300.00299.50302.00301.50299.50300.50299.50300.50299.50300.00299.50300.00 AD299.00 ADADAD ADADADADADADADADAD AD ADADAD ADADAD ADADADADADADADAD ADBLOCK 36(STREET WIDENING)BLOCK 38(0.30 RESERVE)BLOCK 24299.0018.6 39.6ADAD AD CO AD ADADCOADADAD AD AD AD ADAD ADADAD ADAD ADADADAD AD AD AD AD AD AD ADADADCO COCO COCOCOCO CO COCOCOCO CO COCO COCO COCO CO CO COCOCOCO CO COCOCO CO CO ADADADADADADCO CO BLOCK 20 - 420 ADDISON HALL CIRCLE -PROPOSED KEY PLANLANDSCAPE14BUFFERFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEFIRE ROUTE(300 x 450)mmTOW AWAY ZONEFIRE ROUTEDecember 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 39 of 59 BLDG ASTORAGESNOWLANDSCAPECROWN OF ROOT BALL SHALL BEAR SAME RELATIONTO FINISHED GRADE AS IT DID TO PREVIOUS GRADEADDISON HALL CIRCLE- 420 ADDISON HALL CIRCLE -SCALE: 1:300PROPOSED LANDSCAPE PLAN97.856 mN 71° 24' 50" E197.856 mN 71° 24' 50" E100.000 mN 71° 24' 50" E96.700 mN 18° 35' 10" W96.700 mN 18° 35' 10" WNL01Proposed newIndustrial BuildingxxxxFUTUREEXPANSIONAREABUFFERDecember 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 40 of 59 CGCGCGCGCGCGCGCGSPDLSPDLSHOP DRAWINGS TO BE PROVIDEAND APPROVED BY OWNER(S)PRIOR TO MANUFACTURERINGSHOP DRAWINGS TO BE PROVIDEAND APPROVED BY OWNER(S)PRIOR TO MANUFACTURERINGA0Proposed newIndustrial BuildingxxxxCGCGCGCGCGCGCGCGCGCGCGCGSHOP DRAWINGS TO BE PROVIDEAND APPROVED BY OWNER(S)PRIOR TO MANUFACTURERINGSHOP DRAWINGS TO BE PROVIDEAND APPROVED BY OWNER(S)PRIOR TO MANUFACTURERING2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 41 of 59 BLDG AA11PROPOSEDSCALE: 1:200GROUND FLOORPLANUNIT 1UNIT 2 UNIT 3UNIT 411b1c234567892a2c2b2d3a3b3c 4a 4c4b5b6b7b8b6a5c 6c 7c 8a 8cABCDEF4d5a6d7aA01aAxBxByCxDxDyEx123456789NA1Proposed newIndustrial Buildingxxxx2PROPOSEDSCALE: 1:50TYPICAL DETAILENTRY3PROPOSEDSCALE: 1:50MECHANICAL PLAN DETAILA1A14A86A66A66A66A62A12A12A11AA01a2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 42 of 59 BLDG AA11PROPOSEDSCALE: 1:200MEZZANINE FLOORPLANUNIT 1UNIT 2 UNIT 3UNIT 411b1c234567892a2c2b2d3a3b3c 4a 4c4b5b6b7b8b6a5c 6c 7c 8a 8cABCDEF4d5a6d7aA01aAxBxByCxDxDyEx123456789NA2Proposed newIndustrial BuildingxxxxNORTH ELEVATION VIEW2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 43 of 59 NA3Proposed newIndustrial Buildingxxxx123456789ABCDEFA03A63A63A63A63A63A63A63A6A81PROPOSEDSCALE: 1:150ROOF PLAN7A68A67A68A67A68A67A68A63A62021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 44 of 59 A21SCALE: 1:200100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETA22SCALE: 1:200GRADET/O WINDOWS110.254T/O PARAPET B110.954CGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGGRADEGRADEGRADECGCGCG100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETT/O WINDOWS110.254T/O PARAPET B110.954CGCGCGCGCG123456789123456789A23GRADESCALE: 1:200GRADE100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETT/O WINDOWS110.254T/O PARAPET B110.954A24GRADESCALE: 1:200GRADE100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETT/O WINDOWS110.254T/O PARAPET B110.954CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGFEDCBAA0FEDCBAA0A4Proposed newIndustrial BuildingxxxxNORTH ELEVATION VIEWSOUTH ELEVATION VIEWEAST ELEVATION VIEWWEST ELEVATION VIEWEXTERIOR PRECAST PANELWALL SCHEDULECOLOUR TEXTUREABITEMCDAACBBCAACBAACBACBDDDDDDDDDDDDDACDACB1A71A71A71A71A69A62A62A62A62A62A69A69A61A65A65A61A81A82A91A94A94A93A93A92A92A92A72A71A82A91A92A73A82A6DDD2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 45 of 59 A5Proposed newIndustrial Buildingxxxx100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETGRADET/O WINDOWS110.254T/O PARAPET B110.954CGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGGRADE56789Match Line-1100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETGRADET/O WINDOWS110.254T/O PARAPET B110.954CGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG12345Match Line-1A61RIGHTPROPOSEDSCALE: 1:150(SOUTH)PARTIAL ELEVATIONA61RIGHTPROPOSEDSCALE: 1:150(SOUTH)PARTIAL ELEVATIONA24GRADESCALE: 1:200GRADECGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGSPDLSPDLCGCGCGCGCGCGCGCGCGCGCGCGFEDCBAA0WEST ELEVATION VIEW100.00FINISHED FLOOR103.659T/O WINDOWS105.944FINISHED SILL108.382U/S DECK100.915FINISHED SILL109.754T/O PARAPETT/O WINDOWS110.254T/O PARAPET B110.9542021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 46 of 59 GRIDGRIDGRIDGRIDGRIDGRIDGRIDA6Proposed newIndustrial Buildingxxxx2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 47 of 59 GRIDA7Proposed newIndustrial Buildingxxxx2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 48 of 59 GRIDGRIDGRIDGRIDA8Proposed newIndustrial Buildingxxxx2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 49 of 59 GRIDGRID GRIDGRIDA9Proposed newIndustrial Buildingxxxx2021-12-09December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 50 of 59 December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 51 of 59 December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 52 of 59 December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 53 of 59 December 14, 2021DATE: TOWN OF AURORAPLANNING AND DEVELOPMENT SERVICESDevelopment Planning DivisionRECEIVED1SUBMISSION No.Page 54 of 59 100 John West Way Aurora, Ontario L4G 6J1 (905) 727-3123 aurora.ca Town of Aurora Memorandum Corporate Services Re: Site Plan Application OPA-2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2), 162, 306, 370, 434, and 488 St. John’s Sideroad To: Accessibility Advisory Committee From: Mateusz Zawada, Accessibility Advisor Date: March 9, 2022 Recommendation 1. That the memorandum regarding Site Plan Application OPA-2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2), 162, 306, 370, 434, and 488 St. John’s Sideroad, be received; and 2. That the Accessibility Advisory Committee comments regarding Site Plan Application OPA-2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2) be received and referred to staff for consideration and further action as appropriate. Background The Accessibility Advisor has made comments on behalf of the Accessibility Advisory Committee. The following comments are conditions that must be met: Barrier-free parking is required for the proposed neighbourhood park parking lot in block 94. Number of and dimension requirements of barrier-free parking to meet that of the Town of Aurora Zoning By-Law; The developer to incorporate accessibility features, such as sensory and active play components, for children and caregivers with various disabilities into the design of outdoor play spaces; and Ensure that outdoor play spaces have a ground surface that is firm, stable and has impact attenuating properties for injury prevention and sufficient clearance to provide children and caregivers with various disabilities the ability to move through, in and around the outdoor play space; All proposed vistas to have barrier-free access. Page 55 of 59 Site Plan Application OPA-2021-02, ZBA-2021-02, and SUB-2021-01 (Submission #2), 162, 306, 370, 434, and 488 St. John’s Sideroad March 9, 2022 Page 2 of 2 Please also note that there are new Design of Public Spaces (Built Environment) Standards enacted from the Province of Ontario, under the Accessibility for Ontarians with Disabilities Act and revisions to the Ontario Building Code to help standardize and encourage barrier free access. Attachments OPA-2021-02 Page 56 of 59 ST. ANNE’S SCHOOLNATURAL HERITAGEPHASE 2(APPROVED)SCHOOLPARKOPENSPACE/ SWMPHASE 1 (APPROVED)NATURAL HERITAGE RESTORATIONST. JOHN’S SIDEROADYONGE STREETBATHURST STREETFUTUREDEVELOPMENT: MID-RISEPARKPARKMID-RISEPARKMID-RISESWMSWMNATURAL HERITAGENATURAL HERITAGENATURAL HERITAGENATURAL HERITAGEShining Hill Estate Collective LandsLimit of Aurora Draft Plan of SubdivisionNatural Heritage / Open SpaceSingle Detached Residential Townhome ResidentialSchoolNeighbourhood ParkVistasOpen Space/ Stormwater ManagementEnvironmental Restoration AreaCommercialPurposed Multi-use PathsPotential Trails within Shining HillExisting Trails beyond Shining HillSHINING HILL CONCEPTUAL MASTER PLANNovember 16, 2021 | Job # 2374PotentialCommunityAmenity AreaPotentialCommunityAmenity AreaPotentialTrailhead/ Parking AreaTOWN OF NEWMARKETTOWN OF AURORAAttachmentsPage 57 of 59 10.0TAKED BY LSRCA7DRIPLINE STAKED BY LSRCAMAY 24, 20176m LANDSCAPE BUFFERBRPDitchRN AROUNDBLOCK 94NeighbourhoodPark1.61ha12.227.738.9Dripline staked July 2020ST. JOHN'S SIDEROADNEWABLOCK 93SAS4.28ha(10.58ac)Long Term Stable Top of Slope -SoilEngineers January 202113.718.113.713.712.212.212.513.715.215.234.5 19.615.215.2 42.8**32.5 32.5 38.539.939.726.132.215.0 6.0m from Long Term Stable Top ofSlope -Soil Engineers January 20216.0m from Long Term Stable Top ofSlope -Soil Engineers December2020Long Term Stable Top of Slope -SoilEngineers December 2020Staked Dripline July 2020Limit of DraftPlan125.8 48.727.544.747.6 66.592.223.015.0 32.130.030.032.3 32.2 15.2 38.5 43.135.4 33.8 15.2 15.2 16.313.715.212.212.213.713.813.7 13.7 34.633.715.215.215.2 13.713.713.714.715.513.815.913.713.713.723.018.0 35.635.3BLOCK 110Road WideningBLOCK 1120.3m ReserveBLOCK 1130.3m ReserveBLOCK 986.0m Servicing Block0.02 ha12.213.814.916.213.012.212.514.033.0 33.416.329.613.7 14.0 13.7 13.7 13.7 17.032.732.832.8R18.5 R=92.5R =9 0 .0 R=90.0R=90.0R =9 0 .0 R =9 0 .0 R=90.0R =121 .5R =1 2 4 .5 R=115.023.012345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152545556575859606162636465666768697071727374757677787980818283848513.719.943.4 31.9R16.0STREET A STREET B STREET EBLOCK 96Trail Head18.716.821.221.253.0180.2223.3 STREET C36.3 BLOCK 97SWM Facility/Trail Head0.20ha36.7 28.5 18.0 8.56.16.16.16.17.66.17.77.76.111.38.56.16.16.17.630.0 34.413.7 13.9 22.334.47.66.16.119.431.310.07.66.029.7 33.5 10m from Dripline staked July 20208687STREET DBLOCK 886 UNITS14.2 14.1 12.2 12.2 14.332.432.9BLOCK 914 UNITSBLOCK 925 UNITSBLOCK 893 UNITSBLOCK 903 UNITSBLOCK 100Overland Flow0.01ha*17.3 22.9 13.7STREET BSTREET B5317.0 45.817.0 15.2 15.2 15.2 15.2 15.2 15.2 16.4 15.220.130.038.830.132.833.335.5BLOCK 104Vista/Open Space0.02haBLOCK 105Vista/Open Space0.009haBLOCK 106Vista/Open Space0.006haBLOCK 109Vista/Open Space0.005haBLOCK 107Vista/Open Space0.013haBLOCK 108Vista/Open Space0.005ha6.040.522.822.9 25.322.927.919.6BLOCK 102Vista/Open Space0.004haBLOCK 103Vista/Open Space0.005haBLOCK 101Access to SAS0.05ha17.1 32.331.990°16.516.5 20.99.8 BLOCK 99Overland Flow0.003ha14.0 12.2 15.9 13.730.931.712.212.212.232.0 37.2 32.3 31.16.013.7 13.7 12.212.236.132.831.314.012.212.212.212.212.212.214.036.833.9 32.9 32.1 30.3 30.0 30.0 R16.05.712.212.212.212.212.212.212.633.1 31.8 30.1 30.0 30.3 30.0 35.5 30.0 30.030.013.7 13.718.617.045.519.614.66.010.0 10.010.110.045.8 47.9 42.2 15.334.0 32.7 Temporary turningcircle37.56.0BLOCK 111Servicing Block0.02ha1:100001020 50 100m30 40KEYPLANN.T.S.SCHOLLEN & Company Inc.30 Wertheim Court, Unit 15¬Richmond Hill, Ontario L4B 1B9T: 289-695-0009¬¬¬¬¬F: 289-695-0010Drawing Prepared By:Copyright Statement©2020 SCHOLLEN & COMPANY INC. All rights reserved. This document isprotected under copyright law and may not be reproduced in any formwithout the prior written permission of Schollen & Company Inc. Drawingsand Specifications are the property of the Landscape Architect.This document is submitted by Schollen & Company Inc. to the client inconfidence. The document contains confidential and/or technical information,and its unauthorized disclosure could reasonably result in significantprofessional and financial harm to Schollen & Company Inc. Any damagesarising from unauthorized use of this document or the information containedtherein shall be borne by the party making such unauthorized use.Scale:Project No.: Drawing No.:Plot Date:Drawn:Checked:Date:Client:Project Name:Drawing Title:XXYYYY/MO/DAS:\Projects\Shining Hill Aurora-Newmarket 2020029\drawings\concept drawings\Concept plan - Phase 3.dwg11/11/2021AuroraSHINING HILL ESTATESCONCEPT PLANAKDecember 20202020029RMSNovember 202102/11/2021PHASE 3 - SUBDIVISIONPLANTING PLANLEGENDRESTORATION PLANTINGPRIVATE REAR YARD TREESTREET TREE PLANTINGPOTENTIAL TOWN OF AURORACOMMUNITY AMENITY AREAPOTENTIAL TRAIL 3.0m WIDE3m MULTI-USE PATHWAYLP-120215ST. JOHN'S SIDEROADYONGE STREETPROPOSED SITESTREET TREES(WITHIN THE ROAD RIGHTS-OF-WAY) 179 TREESPRIVATE REAR YARD TREES 104 TREESRESTORATION PLANTING TREES 2053 TREESTREES IN THE 2 PARK BLOCKS 75 TREESPage 58 of 59 0 10 25 50 100 150mBLOCK 94NeighbourhoodPark1.61ha12.227.738.9Dripline staked July 2020YONGE STREETST. JOHN'S SIDEROADNEWMARKETAURORAFUTURERESIDENTIALWillow Farm LaneBLOCK 93SAS4.28ha(10.58ac)^^~OOOOOOOO++++Long Term Stable Top of Slope -SoilEngineers January 2021~~~^13.718.113.713.712.212.212.513.715.215.2 34.5 19.615.215.2 42.8^^OO++OOO+++++**32.5 32.5 38.539.939.726.132.215.0 6.0m from Long Term Stable Top ofSlope -Soil Engineers January 20216.0m from Long Term Stable Top ofSlope -Soil Engineers December2020Long Term Stable Top of Slope -SoilEngineers December 2020Staked Dripline July 2020Staked Wetland July 2020Staked Dripline July 2020Limit of DraftPlan125.8 48.727.544.747.6 66.592.223.0++++OO++Future Park 0.13haFuture Open Space0.26ha15.0 32.130.030.032.3 32.2 15.2 38.5 43.135.4 33.8 15.2 15.2 16.313.715.212.212.213.713.813.7 13.7 34.633.715.215.215.2 13.713.713.714.715.513.815.913.713.713.723.018.0 35.635.3BLOCK 95NATURAL HERITAGESYSTEM / OPENSPACE17.77 haBLOCK 110Road Widening0.21haBLOCK 1120.3m ReserveBLOCK 1130.3m ReserveBLOCK 986.0m Servicing Block0.02 ha12.213.814.916.213.012.212.514.033.0 33.416.329.613.7 14.0 13.7 13.7 13.7 17.032.732.832.8R18.5 R=92.5R=90 .0 R=90.0R=90.0R =9 0 .0 R=90.0 R=90.0R =1 2 1 .5R =1 2 4 .5 R=115.0 23.012345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152545556575859606162636465666768697071727374757677787980818283848513.719.943.4 31.9R16.0STREET A STREET B STREET EBLOCK 96Trail Head0.006ha18.716.821.221.253.0180.2223.3 STREET COOO++O++ExistingResidentialExistingResidentialExistingAgriculturalExistingAgriculturalProposed Floodline July 202036.3 ==BLOCK 97SWM Facility/Trail Head0.20ha36.7 28.5 18.0 8.56.16.16.16.17.66.17.77.76.111.38.56.16.16.17.630.0 34.413.7 13.9 22.334.4++7.66.16.119.431.310.07.66.029.733.5 10m from Dripline staked July 2020264.5265267.5264.52678687STREET DBLOCK 886 UNITS14.2 14.1 12.2 12.2 14.332.432.9BLOCK 914 UNITSBLOCK 925 UNITSBLOCK 893 UNITSBLOCK 903 UNITSBLOCK 100Overland Flow0.01ha*===================17.3 22.9 13.7STREET BSTREET B5317.0 45.817.0 15.2 15.2 15.2 15.2 15.2 15.2 16.4 15.220.130.038.830.132.833.335.5BLOCK 104Vista/Open Space0.02haBLOCK 105Vista/Open Space0.009haBLOCK 106Vista/Open Space0.006haBLOCK 109Vista/Open Space0.005haBLOCK 107Vista/Open Space0.013haBLOCK 108Vista/Open Space0.005ha6.040.522.822.9 25.322.927.919.6BLOCK 102Vista/Open Space0.004haBLOCK 103Vista/Open Space0.005haBLOCK 101Access to SAS0.05ha17.1 32.331.990°16.5OO+OOO++OOO16.5 20.99.8 BLOCK 99Overland Flow0.003ha14.0 12.2 15.9 13.730.931.712.212.212.232.0 37.2 32.3 31.16.013.7 13.7 12.212.236.132.831.3++14.012.212.212.212.212.212.214.036.833.9 32.9 32.1 30.3 30.0 30.0 R16.05.712.212.212.212.212.212.212.633.1 31.8 30.1 30.0 30.3 30.0 35.5 30.0 30.030.013.7 13.7 18.617.045.519.614.66.010.010.0 10.010.110.015.0 45.8 47.9 42.2 15.334.0 32.7 Temporary turningcircle37.56.0BLOCK 111Servicing Block0.02haYONGE STREETWillow Farm LaneBATHURST STREET0 40 100 200 400 600mST. JOHN'S SIDEROADNEWMARKETAURORAADDITIONAL INFORMATIONSURVEYOR'S CERTIFICATEDate: March 8, 2021Project No.: 15-2374DateSCHEDULE OF LAND USEOWNER'S AUTHORIZATIONDRAFT PLAN OF Tel: (905) 513-0170 Markham, Ontario, L3R 6B3140 Renfrew Drive, Suite 201www.mgp.caKEY PLANPrepared for:Prepared by:AS REQUIRED UNDER SECTION 51(17) OF THEPLANNING ACT, CHAPTER P.13(R.S.O. 1990).(a),(e),(f),(g),(j),(l) - As shown of the Draft Plan.(b),(c) - As shown on the Draft and Key Plan.(d) - Land to be used in accordance with the Schedule ofLand Use.(i) - Soil is clay loam and sandy loam.(h),(k) - Full municipal services to be provided.I hereby certify that the boundaries of the lands to be subdividedand their relationship to the adjacent lands are correctly shown.I hereby authorize Malone Given Parsons Ltd. to prepare andsubmit this Draft Plan of Subdivision to the Town of Aurora.SUBJECT PROPERTYSUBDIVISIONOTHER LANDS Part of Lot 86, Concession 1Town of AuroraRegional Municipality of YorkOWNED BY APPLICANTSHINING HILL ESTATES COLLECTION INC.NAngelo DeGasperisNeil A. LeGrowLOT / BLOCK LAND USE UNITS AREA1-78 Single Detached Min. 15.24m 23 1.46Single Detached Min. 13.70m 28 1.43Single Detached Min. 12.20m 27 1.1879-87 Lane Access Single Detached Min. 13.70m 5 0.30Lane Access Single Detached Min. 12.20m 4 0.1888-92 Townhouses Min. 6.1m 21 0.5493 Saint Anne's School 4.2894 Neighbourhood Park 1.6195 Natural Heritage / Open Space 17.7796-97 SWM / Trailhead 0.2198 & 111 Servicing Blocks 0.0499-100 Overland Flow 0.01101 Access to Saint Anne's School 0.05102-109 Vista's / Open Space 0.07110 Road Widening 0.21112-113 0.3m Reserves 0.01Street A 23.0m Right of Way 436m 1.02Street B-D 18.0m Right of Way 490m 0.96Street E 16.5m Right of Way 165m 0.27Street B 15.0m Right of Way 160m 0.19TOTAL 108 31.79O~^+Date=See OriginalSee OriginalSee OriginalSee OriginalDate Revision ByOct 7/21 Revise the plan according to Town's comments DRNov 1/21 Add servicing block and temporary turning circle DRPage 59 of 59